STR chr22:46625004-46625018

Motif A repeats 15 times in the reference sequence.


...TCCCAGCTACTGGGGAGGCTGAGGCAGGAGAATGGCATGAACCCGGGAGGCGGAGCTTGCTGTGAGCCAAGATCACGCCACTGCACTCCAGCCTGGGCAA
CAGAGCGAGACTCCATCTCA
AAAAAAAAAAAAAATTATTTAACACCTTTATTTCTGCTGAATGTACTTTAGAAAGATTGAGTGATTTGAATAAAGTGACG
GTGGCCTAAGAGTCTATTTTCTGGAATTGAGGGAATACTGCCATCGATCCTTGA
...


No gene information available



No Data Available.

See the about page for detailed description of each parameter.


No eSTRs found.

See the about page for detailed description of each parameter.


ParameterValue
Mutation model: Mutation rate 4.62e-05
Mutation model: Beta 0.048
Mutation model: P(single step) 1.000
Constraint (Z-score) 0.000
Stutter model: up 0.019
Stutter model: down 0.033
Stutter model: p 0.951
See the about page for detailed description of each parameter.


Locus-level imputation metrics

ParameterValue
SSC - Concordance 1.00
SSC - r 1.00
1000 (EUR) - Concordance 0.99
1000G (EUR) - r 0.98
1000 (AFR) - Concordance 0.96
1000G (AFR) - r 0.97
1000 (EAS) - Concordance 1.00
1000G (EAS) - r 0.00

Allele-level imputation metrics

Allele (bp diff from hg19)r2P-val
-3 1.00 0.000e+00
-2 0.98 0.000e+00
-1 0.98 0.000e+00
0 0.99 0.000e+00
See the about page for detailed description of each parameter.