STR chr22:46623138-46623164

Repeat unit AAAT/ATTT repeats 6 times in the reference sequence.


...TTTCTTTAGATTAAAAAATGTGCTTCATATTTTATGCCATTTCTACAAATGTATAGTAAAACATAACCAAGAGAGCTTATTAAATAATTTCATCCAAAGC
AGTTCTACCAGTGCTTCACATTTATTTTTTATTTATTTATTTATTTTTGAGACTGAGTCTCACTCTCTTGCCCAGGCTGGAGTGCAGTGGCGCAATCTCA
GCTCACTGCAACCTCCCCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCTAAGTAGCTGGG...

No gene information available

No sequence data available.

Parameter Value
Mutation model: Mutation rate 2.40e-08
Mutation model: Beta 0.790
Mutation model: P(single step) 0.991
Constraint (Z-score) -10.784
Stutter model: up 0.000
Stutter model: down 0.000
Stutter model: p 0.750
See the about page for a detailed description of each parameter.