STR chr22:46623138-46623164

Motif AAAT repeats 6 times in the reference sequence.


...TTTCTTTAGATTAAAAAATGTGCTTCATATTTTATGCCATTTCTACAAATGTATAGTAAAACATAACCAAGAGAGCTTATTAAATAATTTCATCCAAAGC
AGTTCTACCAGTGCTTCACA
TTTATTTTTTATTTATTTATTTATTTTTGAGACTGAGTCTCACTCTCTTGCCCAGGCTGGAGTGCAGTGGCGCAATCTCA
GCTCACTGCAACCTCCCCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCTAAGTAGCTGGG
...


No gene information available



No Data Available.

See the about page for detailed description of each parameter.


No eSTRs found.

See the about page for detailed description of each parameter.


ParameterValue
Mutation model: Mutation rate 2.40e-08
Mutation model: Beta 0.790
Mutation model: P(single step) 0.991
Constraint (Z-score) -10.784
Stutter model: up 0.000
Stutter model: down 0.000
Stutter model: p 0.750
See the about page for detailed description of each parameter.


Locus-level imputation metrics

No Data Available.

Allele-level imputation metrics

No Data Available.

See the about page for detailed description of each parameter.