STR chr22:46622758-46622788

Motif A repeats 31 times in the reference sequence.


...GTGCGCCTGTGGTTCCAGCCGCTCAGGAGGCCGAGGCAGGAGGATGGAGGTCAAGACTGCAGTGGACTGTGGTTGCGCCACTGTACTCCAGCCTGGGTGA
CACAGCAAGACCCCGTCTCAAAAAAAGAAAACAGAAAAAAGAAAAAAAAAGTTGAGCAAGGAGACTAATTTGTGACATGCAGCTGAACATGGTTTTTAAG
ACCAGTTTTGAAAGAGGAATTCCAACATTATTCTTAACATTTCAGAAGCCTGGGCATAAGGGTGACCTCC...


No gene information available



No Data Available.

See the about page for detailed description of each parameter.


No eSTRs found.

See the about page for detailed description of each parameter.


ParameterValue
Mutation model: Mutation rate 2.40e-08
Mutation model: Beta 0.006
Mutation model: P(single step) 0.999
Constraint (Z-score) 0.000
Stutter model: up 0.002
Stutter model: down 0.003
Stutter model: p 0.959
See the about page for detailed description of each parameter.


Locus-level imputation metrics

No Data Available.

Allele-level imputation metrics

No Data Available.

See the about page for detailed description of each parameter.