STR chr22:46621737-46621756

Motif AC repeats 10 times in the reference sequence.


...ACACAAGCATCCATGCTCACATGGGTACACACTCACACATCCATGCATGCACGTGTAAACACACACACCCCCACACATACACGTGCACCCACACATGCAC
ACAGACGCACCTCCACCCCC
ACACACGCACACACACACATGCACCCACACATGGATACACGCACACTCACACATGTACCCACACCTGTGTGTACACACAC
ACATGCATGCTCACACACATGCACCCAGGCACACACAAATCCACATTCACCCATACAGT
...


No gene information available



No Data Available.

See the about page for detailed description of each parameter.


No eSTRs found.

See the about page for detailed description of each parameter.


ParameterValue
Mutation model: Mutation rate 2.40e-08
Mutation model: Beta 0.070
Mutation model: P(single step) 0.900
Constraint (Z-score) -11.094
Stutter model: up 0.000
Stutter model: down 0.005
Stutter model: p 0.879
See the about page for detailed description of each parameter.


Locus-level imputation metrics

No Data Available.

Allele-level imputation metrics

No Data Available.

See the about page for detailed description of each parameter.