STR chr22:46619540-46619555

Motif A repeats 16 times in the reference sequence.


...TCCCAACTACCCAGGAGGCTGAGGCAGGAGAATTGCTTGAACCTGGAAGGCAGAGGTTGCAGTGAGCCGAGATCACACCACTGCACTCCAGCCTGGGTGA
CAGAGCGAGACTCCATCTCA
AAAAAAAAAAAAAAAGAGGGCCAGGCGTGGTTGCTCATGCTTATGCCTGTAATCCCAGCACTGTGGGAGGCAGAGGAGGG
CGGATTACCTGAGCTCAGGAGTTCGAGACCAGCCTGGGCAACATGGTAAAACCCC
...


No gene information available



No Data Available.

See the about page for detailed description of each parameter.


No eSTRs found.

See the about page for detailed description of each parameter.


ParameterValue
Mutation model: Mutation rate 7.27e-05
Mutation model: Beta 0.900
Mutation model: P(single step) 1.000
Constraint (Z-score) 0.000
Stutter model: up 0.031
Stutter model: down 0.059
Stutter model: p 0.885
See the about page for detailed description of each parameter.


Locus-level imputation metrics

No Data Available.

Allele-level imputation metrics

No Data Available.

See the about page for detailed description of each parameter.