STR chr22:46616542-46616554

Motif A repeats 13 times in the reference sequence.


...AGATGAGATGTTTCCCAGGCTGGTCTCAAACTCCTGGCCTCAAGTGATCTTCCCACCTCGGCCTCCCAAAGCACTGGCATTACAGGTGTGAGTCATGGCA
CCCAGCATTAACTGGATTTA
AAAAAAAAAAAACTGACCAGGCAAGATGGGTCATGCCTGTAATCCTGGCACTCTGGGGAGGCCAAGGTGGGCAGATTGCT
TGAGTCCAGGAGTTTGATACCAGCCTGGCCAACATGGAGAAACCCCAACTCT
...


No gene information available



No Data Available.

See the about page for detailed description of each parameter.


No eSTRs found.

See the about page for detailed description of each parameter.


ParameterValue
Mutation model: Mutation rate 6.41e-07
Mutation model: Beta 0.711
Mutation model: P(single step) 1.000
Constraint (Z-score) 0.000
Stutter model: up 0.012
Stutter model: down 0.022
Stutter model: p 0.914
See the about page for detailed description of each parameter.


Locus-level imputation metrics

No Data Available.

Allele-level imputation metrics

No Data Available.

See the about page for detailed description of each parameter.