STR chr22:46616387-46616415

Motif AAAAC repeats 5 times in the reference sequence.


...GTGGTGCAATCATAGTTCACTGCAGCCTTGAACTCCTGGGCTCAAGCAATCCTCCTGCCTCAGCCTCCCAAGGAGCTGGGACTACAGGTGTGCACCACCA
CACCTGGCTATGTTTGATGT
TGTTGTTGTTTTGTTTTGTTTTTGTTTTTTGGTAGAGATGAGATGTTTCCCAGGCTGGTCTCAAACTCCTGGCCTCAAGT
GATCTTCCCACCTCGGCCTCCCAAAGCACTGGCATTACAGGTGTGAGTCATGGCACCCAGCATTAACT
...


No gene information available



No Data Available.

See the about page for detailed description of each parameter.


No eSTRs found.

See the about page for detailed description of each parameter.


ParameterValue
Mutation model: Mutation rate 2.40e-08
Mutation model: Beta 0.356
Mutation model: P(single step) 0.857
Constraint (Z-score) 0.000
Stutter model: up 0.000
Stutter model: down 0.000
Stutter model: p 0.667
See the about page for detailed description of each parameter.


Locus-level imputation metrics

No Data Available.

Allele-level imputation metrics

No Data Available.

See the about page for detailed description of each parameter.