STR chr2:21266752-21266797

Repeat unit AGC/GCT repeats 15 times in the reference sequence.

...GTGGCTGCCCTCCCTCTGGCCTAGGCCCAGGCTGCCCCGGCCAACCTCGTGCCGCCGGCTCCCTCCCGCTCCCTCTGCGCCCGCAGAGCGGCCGCGCACT
CACCGGCCCTGGCGCCCGCCAGCAGCAGCAGCAGCAGCGCAGGCAGCGCCAGCAGCGCCAGCAGCGCGGGCCTCGGCGGGTCCATCGCCAGCTGCGGTGG
GGCGGCTCCTGGGCTGCGGCCTGGCCTCGGCCTCGCGGCCCTGGCTGGCTGGGCGGGCTCCTCAGCGGCAGCAACCGAGAAGGGC...

Gene (ENS)	Tissue	Beta (SE)	P-value	CAVIAR
APOB (ENSG00000084674.9)	Artery-Tibial	0.23 (0.06)	1.85e-04	0.10

See the about page for a detailed description of each parameter.

No sequence data available.

Parameter	Value
Mutation model: Mutation rate	6.40e-05
Mutation model: Beta	0.000
Mutation model: P(single step)	0.700
Constraint (Z-score)	1.062
Stutter model: up	0.000
Stutter model: down	0.001
Stutter model: p	0.684

See the about page for a detailed description of each parameter.

Locus-level imputation metrics

Parameter	Value
SSC - Concordance	0.99
SSC - r	0.98
1000 (EUR) - Concordance	1.00
1000G (EUR) - r	1.00
1000 (AFR) - Concordance	0.91
1000G (AFR) - r	0.75
1000 (EAS) - Concordance	0.99
1000G (EAS) - r	0.95

Allele-level imputation metrics

Allele (bp diff from hg19)	r2	P-val
-9	0.96	0.000e+00
0	0.95	0.000e+00
6	nan	1.000e+00

See the about page for a detailed description of each parameter.