STR chr2:21266752-21266797

Repeat unit AGC/GCT repeats 15 times in the reference sequence.


...GTGGCTGCCCTCCCTCTGGCCTAGGCCCAGGCTGCCCCGGCCAACCTCGTGCCGCCGGCTCCCTCCCGCTCCCTCTGCGCCCGCAGAGCGGCCGCGCACT
CACCGGCCCTGGCGCCCGCC
AGCAGCAGCAGCAGCAGCGCAGGCAGCGCCAGCAGCGCCAGCAGCGCGGGCCTCGGCGGGTCCATCGCCAGCTGCGGTGG
GGCGGCTCCTGGGCTGCGGCCTGGCCTCGGCCTCGCGGCCCTGGCTGGCTGGGCGGGCTCCTCAGCGGCAGCAACCGAGAAGGGC
...

Gene (ENS) Tissue Beta (SE) P-value CAVIAR
APOB (ENSG00000084674.9) Artery-Tibial 0.23 (0.06) 1.85e-04 0.10
See the about page for a detailed description of each parameter.
No sequence data available.

Parameter Value
Mutation model: Mutation rate 6.40e-05
Mutation model: Beta 0.000
Mutation model: P(single step) 0.700
Constraint (Z-score) 1.062
Stutter model: up 0.000
Stutter model: down 0.001
Stutter model: p 0.684
See the about page for a detailed description of each parameter.

Locus-level imputation metrics

Parameter Value
SSC - Concordance 0.99
SSC - r 0.98
1000 (EUR) - Concordance 1.00
1000G (EUR) - r 1.00
1000 (AFR) - Concordance 0.91
1000G (AFR) - r 0.75
1000 (EAS) - Concordance 0.99
1000G (EAS) - r 0.95

Allele-level imputation metrics

Allele (bp diff from hg19) r2 P-val
-9 0.96 0.000e+00
0 0.95 0.000e+00
6 nan 1.000e+00
See the about page for a detailed description of each parameter.