STR chr12:12878680-12878694

Repeat unit A/T repeats 15 times in the reference sequence.


...CGAATCTCCCGCGGCCCCAGCCCCCGCGCCCGCCCGGGGCCCCTCCCCGCCTCGCGCGCCGCGCGCGGCCTCCGCCCACCTCCCACTTCTTCCCCATTGG
CCGGCGCGTGCAGTTTGAAT
TTTTTTTTTTTTTTGATGCTTGTTTTCTTGTAAAAAATACAGTCCCCCAGATCGTGTGACGAAACCTGCTTCGGCGGCCC
GAGGTGGGGGTTTTGAGTCGGTTAGTGGAGGCAGTGGGAGCAGGATGGGCGGAG
...

No sequence data available.

Parameter Value
Mutation model: Mutation rate 7.26e-05
Mutation model: Beta 0.123
Mutation model: P(single step) 1.000
Constraint (Z-score) 0.000
Stutter model: up 0.027
Stutter model: down 0.045
Stutter model: p 0.927
See the about page for a detailed description of each parameter.

Locus-level imputation metrics

Parameter Value
SSC - Concordance 0.99
SSC - r 0.99
1000 (EUR) - Concordance 0.98
1000G (EUR) - r 0.97
1000 (AFR) - Concordance 0.94
1000G (AFR) - r 0.87
1000 (EAS) - Concordance 0.98
1000G (EAS) - r 0.97

Allele-level imputation metrics

Allele (bp diff from hg19) r2 P-val
-2 nan 1.000e+00
-1 0.98 0.000e+00
0 0.97 0.000e+00
1 0.98 0.000e+00
2 0.85 0.000e+00
See the about page for a detailed description of each parameter.