STR chr6:90121977-90121990

Repeat unit AG/CT repeats 7 times in the reference sequence.


...CCCGGCGGGCGGCGCCCAGGTCCGGGTCCCGCGGTTCCCAGCGCGCCCGAAGCCCCCTCCCCCGCCCCGCCCGCCGGCGGAGGAGTCAGCCGGAGCGCGG
CAGTTCCTCCCGGAGGAGGG
AGAGAGAGAGAGACTGCGTGACCCGAGTCACCTGACACACACTGTCACATACTCACATACACACCCCGCACGGGCGCGCG
CGCGCTCGCCCGGCCGCGGGCACCACTCGGCGGGGCGCTGGGCCGAGGACACA
...

No gene information available

68100100200300400500600700800681001020304050606810010203040506070806810010203040506070
PopulationsGtex1000 Genomes Africa1000 Genomes East Asia1000 Genomes EuropeNumber of motif copiesCount in a population
No sequence data available.

Parameter Value
Mutation model: Mutation rate 4.91e-05
Mutation model: Beta 0.476
Mutation model: P(single step) 0.700
Constraint (Z-score) 0.000
Stutter model: up 0.001
Stutter model: down 0.005
Stutter model: p 0.899
See the about page for a detailed description of each parameter.

Locus-level imputation metrics

Parameter Value
SSC - Concordance 0.98
SSC - r 0.95
1000 (EUR) - Concordance 0.99
1000G (EUR) - r 0.98
1000 (AFR) - Concordance 0.87
1000G (AFR) - r 0.84
1000 (EAS) - Concordance 0.92
1000G (EAS) - r 0.82

Allele-level imputation metrics

Allele (bp diff from hg19) r2 P-val
-2 nan 1.000e+00
0 0.90 0.000e+00
4 0.91 0.000e+00
See the about page for a detailed description of each parameter.