STR chr2:176957786-176957827

Repeat unit CCG/CGG repeats 14 times in the reference sequence.


...GGGGGCGCCGGTGGCGCCCCGGCCTCTTCCTCCTCCTCATCGGTGGCGGCGGCGGCGGCGTCAGGCCAGTGCCGCGGCTTTCTCTCCGCGCCTGTGTTCG
CCGGGACGCATTCGGGGCGGGCGGCGGCGGCGGCAGCGGCGGCTGCGGCGGCGGCGGCGGCAGCCTCCGGCTTTGCGTACCCCGGGACCTCTGAGCGCAC
GGGCTCTTCCTCGTCGTCGTCCTCTTCTGCCGTTGTAGCGGCGCGCCCGGAGGCTCCCCCAGCCAAAGAGTGCCCAGCACC...

No gene information available

No sequence data available.

Parameter Value
Mutation model: Mutation rate 2.40e-08
Mutation model: Beta 0.445
Mutation model: P(single step) 0.700
Constraint (Z-score) -10.876
Stutter model: up 0.001
Stutter model: down 0.002
Stutter model: p 0.800
See the about page for a detailed description of each parameter.