STR chr15:51515456-51515482

Repeat unit AATG/CATT repeats 6 times in the reference sequence.


...GCTTACCAGTCTTCCCTCACTGAACTGAGAGCTCTTTAAGGACAGTGACAGCCACTCATTAGCATTGCACTTCAAGCTGATGGTCCATGGGGGCCTTCAT
ACATATTTTTTCAATAGAGGAATGAATGAATGAATGAATGAATGAAAATAGAGTAAACTGGCTTTGATCTTACTCTTGCCCTGTTCATATCTGAGCAGTG
GCTGGTGGGTCCTGATGGTAGGTGGCCTACACAGGAGGGTTTAACCCTTAAAGTGCCCCTTTCTCT...

No gene information available

46810020040060080046810010203040506070468100102030405060708090468100102030405060
PopulationsGtex1000 Genomes Africa1000 Genomes East Asia1000 Genomes EuropeNumber of motif copiesCount in a population
Gene (ENS) Tissue Beta (SE) P-value CAVIAR
CYP19A1 (ENSG00000137869.9) WholeBlood 0.35 (0.05) 4.17e-11 0.48
See the about page for a detailed description of each parameter.
No sequence data available.

Parameter Value
Mutation model: Mutation rate 2.93e-05
Mutation model: Beta 0.892
Mutation model: P(single step) 1.000
Constraint (Z-score) -0.474
Stutter model: up 0.001
Stutter model: down 0.002
Stutter model: p 0.926
See the about page for a detailed description of each parameter.

Locus-level imputation metrics

Parameter Value
SSC - Concordance 0.99
SSC - r 0.98
1000 (EUR) - Concordance 0.98
1000G (EUR) - r 0.96
1000 (AFR) - Concordance 0.93
1000G (AFR) - r 0.82
1000 (EAS) - Concordance 0.98
1000G (EAS) - r 0.88

Allele-level imputation metrics

Allele (bp diff from hg19) r2 P-val
0 0.95 0.000e+00
4 0.94 0.000e+00
16 nan 1.000e+00
See the about page for a detailed description of each parameter.