STR chr9:133556993-133557028

Repeat unit CCG/CGG repeats 12 times in the reference sequence.


...TACTCGCAGCTGGCCGGCCTGCGCGCCCACCAGAAGAGCGCGCGGCACCGGCCGCCCAGCACCGCGCTGCAGGCACACTCGCCCGCGCTGCCCGCCCCGC
ACGCGCACGCGCCCGCGCTC
GCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCGCACCACCTGCCGGCCATGGTGCTGTGAGCGCGCCCGCGCCCCCG
CCGGGCCCCGCGCGCTCCTGGGTCCCCGGCACCCCGGCCCCGCAGCGCGACTCGCCCTCCAGCCCCAACCCCCGG
...

No gene information available

No sequence data available.

Parameter Value
Mutation model: Mutation rate 4.18e-04
Mutation model: Beta 0.237
Mutation model: P(single step) 0.700
Constraint (Z-score) 1.332
Stutter model: up 0.001
Stutter model: down 0.008
Stutter model: p 0.927
See the about page for a detailed description of each parameter.

Locus-level imputation metrics

Parameter Value
SSC - Concordance 0.96
SSC - r 0.86
1000 (EUR) - Concordance 0.95
1000G (EUR) - r 0.88
1000 (AFR) - Concordance 0.88
1000G (AFR) - r 0.58
1000 (EAS) - Concordance 0.94
1000G (EAS) - r 0.90

Allele-level imputation metrics

Allele (bp diff from hg19) r2 P-val
-21 nan 1.000e+00
-18 0.69 2.302e-243
-15 0.85 0.000e+00
-12 0.00 8.710e-01
-9 0.90 0.000e+00
0 0.89 0.000e+00
3 0.92 0.000e+00
6 0.73 8.434e-271
9 nan 1.000e+00
12 nan 1.000e+00
See the about page for a detailed description of each parameter.