STR chr1:204527033-204527059

Repeat unit AAT/ATT repeats 9 times in the reference sequence.


...TTCCGATCAGAGAATCACAAGAGCAGCAAATGTGGTTTCATCAAGTGGGAAGAAAGCAGCAATTTAAAATAACTTTTTGGGAGACTGAATTGAGTAATAA
TAAAACTTCAGTCTTTCGCTAATAATAATAATAATAATAATAATAACAACAACTTATTGAATGTGGCCAGCTCACTAGATGAGGAAAGAGGAAGGCATTT
TCTGCATTCTTGCCTAGTTTTCCTTATAAGCACCACTAAGTTAATAGCTCTGTCTTTTTGGTGTTT...

No gene information available

68101201002003004005006007006810120102030405060681012010203040506068101201020304050
PopulationsGtex1000 Genomes Africa1000 Genomes East Asia1000 Genomes EuropeNumber of motif copiesCount in a population
No sequence data available.

Parameter Value
Mutation model: Mutation rate 1.89e-04
Mutation model: Beta 0.900
Mutation model: P(single step) 0.995
Constraint (Z-score) 1.434
Stutter model: up 0.002
Stutter model: down 0.014
Stutter model: p 0.922
See the about page for a detailed description of each parameter.

Locus-level imputation metrics

Parameter Value
SSC - Concordance 0.97
SSC - r 0.97
1000 (EUR) - Concordance 0.99
1000G (EUR) - r 0.99
1000 (AFR) - Concordance 0.96
1000G (AFR) - r 0.96
1000 (EAS) - Concordance 0.98
1000G (EAS) - r 0.95

Allele-level imputation metrics

Allele (bp diff from hg19) r2 P-val
-6 0.99 0.000e+00
-3 0.95 0.000e+00
0 0.90 0.000e+00
3 0.82 0.000e+00
6 nan 1.000e+00
See the about page for a detailed description of each parameter.