STR chr3:171498332-171498342

Repeat unit A/T repeats 11 times in the reference sequence.


...ACATATTTTCACCACAGACTGACTGAGGGTGAATAAAGGAGGGATGTCTGAGGACTGACACTCAGGACTCTCCAACATTTAAATACCAGGAAGAAGAGAT
GGGTCCAGTAAAGGGGGCCA
AAAAAAAAAATGCCAGTGGGGTAGTAGGAAACCCAGGAGAGTGTGGTGAGAAAGACAGAAGCCAGGTGAAAAGAGTGCGT
CAATGATAGAGAGATCAATTATGTCAAAGGAGCTGAGAGATGAAGAAAGA
...

No gene information available

No sequence data available.

Parameter Value
Mutation model: Mutation rate 7.10e-05
Mutation model: Beta 0.516
Mutation model: P(single step) 0.969
Constraint (Z-score) 0.000
Stutter model: up 0.005
Stutter model: down 0.011
Stutter model: p 0.960
See the about page for a detailed description of each parameter.

Locus-level imputation metrics

Parameter Value
SSC - Concordance 0.99
SSC - r 0.97
1000 (EUR) - Concordance 1.00
1000G (EUR) - r 1.00
1000 (AFR) - Concordance 0.88
1000G (AFR) - r 0.74
1000 (EAS) - Concordance 0.91
1000G (EAS) - r 0.96

Allele-level imputation metrics

Allele (bp diff from hg19) r2 P-val
-2 0.96 0.000e+00
-1 0.98 0.000e+00
0 0.95 0.000e+00
See the about page for a detailed description of each parameter.